Molecular Characterization and Diversity Analysis viz SSR Markers in Linseed (Linum usitatissimum L.) Germplasm

Molecular Characterization and Diversity Analysis viz SSR Markers in Linseed (Linum usitatissimum L.) Germplasm

Vishwaraj Bhajantri¹ , Shakunthala. N. M^1* , S. B. Verulkar² , Ritu R. Saxena² , Vasudevan. S. N¹ , Sangeeta I. Macha² , Kisan B² , Hemant Sahu² , Sonal U²

¹Department of Genetics and Plant Breeding, College of Agriculture I G K V Raipur, Chhattisgarh, India

²Department of Seed Science and Technology UAS, Raichur-584104 Karnataka, India

Corresponding Author Email: shakuntalanm30@gmail.com

DOI : http://dx.doi.org/10.53709/CHE.2020.v01i01.011

Abstract

Keywords

Download this article as:

Introduction

Linseed or flax (Linum usitatissimum) is a multipurpose crop grown in many food, feed, fibre, and industry environments. The availability of diverse germplasm of characterization data and evaluation data is of greatest importance to realize the potential of flax in agriculture. The fibre from flax is a widely used and valuable raw material for textiles, thread/rope and packaging materials, the straw and short fibre for pulp to produce special papers: for cigarettes, currency notes and artwork; and the wooden part serves as biomass energy or litter in cattle farming [1-7]. The strength, nonelasticity, repeated flexibility and its recyclable nature, with a low density, was desirable for use as a rope and thread, interest in its use. Linum usitatissimum, the only cultivated species from the genus Linum, has been cultivated for oil from the start of agriculture 8,000 years ago and slightly later for fibre [8-14]. [15] suggest that the cultivated species arise from a single domestication event from L. bienne, and the first domestication characters involved selection for annual habit, non-shattering of capsules and more efficient self-fertilization [17-21]. Microsatellites or simple sequence repeats (SSRs) consist of tandemly repeated short motifs of 2–6 nucleotides. SSR markers are based on the amplification size polymorphism generated when lines have the variable number of these short tandem repeats in a particular locus. SSR markers’ abundance, distribution, reproducibility, and co dominant nature make them highly suitable for linkage mapping and genetic diversity studies [22-27]. SSR markers have been developed through SSR-enriched library screening and more recently, by mining EST or genomic sequence data. The present study is a step to select diverse genotypes for the flax breeding programme, which can be directly used as a variety or as a parent in crossing programmes to develop hybrids. The main objective of this study was to assess the genetic diversity of flax cultivars using DNA-based molecular markers.

Material and Methods

            The experimental material comprised of 13 linseed genotypes from AICRP on Kanpur,. From these genotypes, leaves were selected to DNA extraction, quantification and PCR amplification using SSR markers to generate genotypic dataduring rabi 2016-17. A total of 39 lines were selected from the 13 linseed fibre genotypes from the field. From each of the 39 selected lines one plant was used for the analysis. DNA was extracted from each leaf sample of 39 individual plants using the protocol as mentioned above described by Kang et al. (1998). The isolated DNA was amplified using the SSR marker. PCR products were separated using 5% PAGE, stained with ethidium bromide and photographed under UV light using image Gel Doc Lab TM software version 2.0.1(Bio–Rad, U.S.A).

List of primers used

Sl. No.	Primers	Sequence 5,—————>3, (SSR primers)
1	LU1	F:TCATTCATCTCCTTCCACTAAAA R:TTGAAAGCCCTAGTAGACACCA
2	LU2	F:TCCGGACCCTTTCAATATCA R:AACTACCGCCGGTGATGA
3	LU3	F:TTCTCCATCATCTCACATCCA R: CCAAATCAGAATGTGCGTGT
4	LU4	F:GGAAGAATTGGAAGAGGAAGG R:CCTTCTCCCATGATCAAACAA
5	LU5	F:GTCACTGGGTGTGTGTTTGC R:AGCAGAAGAAGATGGCGAAA
6	LU6	F:CCCCATTTCTACCATCTCCTT R:CAACAGCGGAACTGATGAAA
7	LU7	F:CATCCAACAAAGGGTGGTG R:GGAACAAAGGGTAGCCATGA
8	LU8	F:TCCCGTAATATTCTATGTTCTTCC R:TGAGTTGGACCTTACAAGACTCA
9	LU9	F:TTGCGTGATTATCTGCTTCG R:ATGGCAGGTTCTGCTGTTTC
10	LU10	F:GCCTAAAGCTGATGCGTTTC R:TGTCAGGCTCCTTCTTTTGC
11	LU11	F:ATGGCAGGTTCTGCTGTTTC R:TTGCGTGATTATCTGCTTCG
12	LU12	F:ACGCGTAAACTTTCCGTTTC R: ATAATGTCGGCTGCTTCTGC
13	LU21	F:AAGGGTGGTGGTGGGAAC R:GTTGGGGTGAAGAGGAACAA
14	LU22	F:GATGGGGTTGAAGCCAGTAG R:CCCACCCCATCTATCATTTG

Table 1. Analysis of SSR banding pattern for linseed genotypes

Primers	Total number of bands	Polymorphic bands	Polymorphism (%)
LU-1	12	9	75
LU-2	13	8	61.53
LU-3	12	9	75
LU-4	10	3	30
LU-5	11	7	63.63
LU-6	10	4	40
LU-7	9	6	66.66
LU-8	10	7	70
LU-9	11	6	54.54
LU-10	13	10	76.92
LU-11	13	12	92.30
LU-21	13	13	100
LU-22	13	12	92.30
Total	150	106	898
Average	11.53	8.15	69.07

Plate 1(a):  PCR amplified linseed genotypes with LU-21 and LU-22 primer

DNA quantification

The concentrations and quality of genomic DNA samples were estimated on spectrophotometer Nano Drop-2000 (Nanodrop, USA) and the genomic DNA samples were diluted to a final concentration of 40 ng/ μl with Sigma water (10 mMTris – HCL, PH 6.0; 1 Mm EDTA) and stored at -20 ºC for further use.

Plate 1(c):  PCR amplified linseed genotypes with LU-6 and LU-7 primer

Fig-1. Hierachical horizontal- dendrogram showing clustering of 13 linssed     genotypes by NTYSS Software

Assembling and pouring the gel

Gasket was fixed to the three sides of the outer plate (without notches). Spacers of 1.5 mm thickness were placed along the sides by just attaching the gasket of the outer plate. Later, notch plate was kept on the outer plate so that spacers were between the two plates. Clamps were put on the three sides of the plates, leaving notch side of the unit. It was checked with water to found any leakages. For casting each gel, 65 ml of acrylamide gel (5%) solution was prepared just prior to pouring. For every 65 ml of solution, 70 μl of TEMED (N-N-N’-N’-Tetramethylethylenediamine and 700 μl of (freshly prepared) 10 % ammonium persulphate (APS) were added to initiate the Polymerization process. The contents were mixed gently by swirling, but bubbles were avoided. Before pouring, assembly was kept on the benchtop so that it made 45-degree angles with bench top. Then gel solution was poured from notch side with maximum care to avoid air bubbles. The comb of 1.5 mm thickness (63 wells) are inserted with the tooth side in the gel. Later assembly was kept for polymerization for 20- 30 min.

Cluster number	Genotypes
1  (5)	Shikha Gaurav Pcl-16-2 Paravati Meera
2  (4)	Nagarkot Pratapalsi Ruchi JRF-3
3  (1)	JRF-4
4 (3)	Rashmi Jeevan JRF-1

Table 3.  Distribution of 13 Linseed genotypes in different clusters in linseed genotypes.

Results and Discussion

14 primers produced a total of 150 amplified productamong these, 106 were polymorphic with an average of 69.07 per cent polymorphism. Only one primer, LU-21 showed the highest (100%) polymorphism, followed by primer LU-11 and LU-22 (92.30%). The primer LU-4 gave the lowest polymorphism (30%). The  bands ranged from 9 (LU-7) to 13 (LU-11, LU-21 and LU-22) with an average of 11.53 bands per primers Table 1.

SSR had much more polymorphism than most of other DNA markers, and is co-dominant and  more significant in quantity. Therefore, the high polymorphic information content of SSR had prompted the application of microsatellites as molecular markers in fingerprinting.

Conclusion

In this study, 14 SSR primer pairs associated with 13 genotypes were assessed on 5% PAGE GEL. Although the PCR products of the DNA samples on the PAGE did appear all show polymorphism except one primer among the genotypes. This is due to very more minor base pair differences in size range of the primers.

References

1. Bekele, A, Alemaw, G. and Zeleke, H, 2012. Genetic divergence among soybean  (Glycine max (L) Merrill) introductions in Ethiopia based on agronomic traits. J. Bio. Agric. Health care, 2(6):6-12.
2.  Bhat, K.V. and Suman Lakhanpaul, 2000. Development of molecular markers for the study of genetic diversity in sesame. NBPGR. Annual Report , New Delhi, pp.57-58.
3.  Cloutier , S, Ragupathy, R, Niu, Z. and Duguid, S, 2009.  SSR-based linkage map of flax (Linum usitatissimum L.) and mapping of QTLs underlyingfatty acid composition traits. Mol Breed., 28:437–451.
4.  Cooke, R. J, 1984. The use of SDS polyacrylamide gel electrophoresis in varietal identification. Biochemical tests for cultivar identification. Proceedings of an ISTA symposium held at the National Institute of Agricultural Botany, Cambridge, UK, on 12-15 September, 1983, Pp. 107-108.
5.  Dallas, J. F, 1988, Detection of DNA ‘fingerprints’ of cultivated rice by hybridization with a human minisatellite DNA probe. Proc. Natl. Acad. Sci., USA. 85: 6831-6835.
6.  De, R. N., Reddy, J. N., Rao, S., and Mohanty K. K. 1992, Genetic divergence of rice under two situations. Indian J. Genet.,25:46-56
7.  Diederichsen, A. and K. Richards 2003. Cultivated flax and the genus Linum L. : taxonomy and germplasm conservation. In: Muir AD, Westcott ND (eds) Flax: the genus Linum. CRC Press, London,          pp 22–54.
8.  Ellis, J. R. and Burke, J. M, 2007. EST-SSRs as a resource for population genetics           analysis. Heredity, 99: 125-132.
9.  Encheva, J, Kohler, H, Christov, M. and Friedt, W, 2005. Intergeneric hybrids between    cultivated sunflower (Helianthus annuus L.) and Verbesina helianthoides        (Genus verbesina), RAPD  and SSR analysis. Helia, 28: 37-44.
10. Fu, Y. B. 2011. Genetic evidence for early flax domestication with capsular dehiscence.             Genet. Resour. Crop Evol., 58 : 1119-1128.
11. Gulhanercan, A, Melih Taskin and Kenan Turgut, 2004. Analysis of genetic diversity in             Turkish sesame populations using SSR and RAPD marker. Genetic Resources and            crop Evaluation. 51:599-607.
12. Gupta, P. K. and Varshney, R. K, 2000. The development and use of micro satellite markers for genetic  analysis and plant breeding with emphasis  on bread wheat. Euphytica, 113:163-185.
13. Gururajan, K.N. and Manickam, S, 2002. Genetic divergence in Egyptian cotton   (Gossypium            barbadense L.). J. Indian Soc. Cotton Improv., 27: 77-83.
14. Kang, H. W, Yong, G. C, Unghan, Y. and Moo, Y. E., 1998. A rapid DNA extraction method for RFLP and PCR analysis from a single dry seed.  Plant. Mol Bio Rep., 16 : 1-9.
15. Kowsalya, R. and Raveendran, T.S., 1996. Correlation and path coefficient analysis in cotton. Madras Agric. J, 83: 705-707.
16. Mahalanobis, P.C.1936. On the generalized distance in statistics. Proceedings of National Academy of Sciences India 2: 49-55.
17. Manimaran, R. and Raveendran, T.S, 2001. Relationship between genetic diversity and heterosis in cotton. Crop Res, 22: 72-77.
18. Mulatani, D.S nd Lyon, B.R, 1995 Gentic fingerprinting of Australia cotton cultivars with molecular markers. Genome, 38:1005-1008.
19. Murthy, B. R, and Arunachalam, V, 1966. The nature of genetic divergence in relation to breeding system in crop plants. Indian J. Genet, 26(A): 188-198.
20. Richharia, R. H. 1962. Linseed. The Indian Central Oilseeds Committee, Hyderabad, India: 155.
21. Rowland, G. G. (1998). Growing flax : Production, management and diagnostic guide. Flax             Council of Canada andSaskatchewan Flax Development Commission.
22. Silvanacrieste, Sin, Moistsai, Jose, I. M., Valls. Marcos, A. and Gimenes, 2005. Genetic             characterization of Brazilian annual Arachis species from sections Arachis and      heteranthae using molecular markers. Genetic Research and Crop Evaluation, 52: 1079-1086.
23. Subramanian, V, Gurty, S, Nageswar, R. C. And Nigam, S. N, 2000, identification of DNA polymorphism in cultivated groundnut using random amplified polymorphic DNA (RAPD) assay. Genome, 43:656-660.
24. Tadesse, T., H. Singh and B. Weyessa 2009. Genetic Divergence in Linseed Germplasm. J.            Innov. Dev. Strategy, 3(2): 13-20.
25. Vavilov, N. I. 1935. Studies on the origin of cultivated plants. Bot. Pl. Breed, 16 : 39-145.
26. Wang, Z., N. Hobson and L. Galindo 2012. The genome of flax (Linum usitatissimum L.) assembled de novo from short shotgun sequence reads. Plant J, 72 : 461-473.
27. Zohary, D. and M. Hopf 2000. Domestication of plants in the Old World : The origin and spread of cultivated plants in West Asia, Europe and the Nile Valley. Oxford University Press, Oxford.